Um, **WHICH** DNA sequence is "THIS" DNA sequence? The one given to us in (a), or the complementary one we just figured out for (a)? We get two totally different answers depending upon which strand's sequence we use.
I am going to ASSUME (ALL OF US ARE FORCED TO ASSUME ONE WAY OR THE OTHER, because your teacher is a fail) that it is the complementary sequence we figured out for (a), because it runs in the correct direction (3'->5') for transcription, and because it is the last strand alluded to before the use the word "this".
For transcription, we again apply the base pairing rules, writing the complementary base beneath each of the bases in the original strand. However, since RNA has U instead of T, wherever there would be a T in the RNA we use U instead.
Answers & Comments
Verified answer
a) 3'-GGTTAATCCCAATCCCAATCCC-5'
We just use simple A-T and C-G base pairing rules, writing the complementary base for the new strand under it's partner in the original strand.
5’-CCAATTAGGGTTAGGGTTAGGG-3’ (strand provided)
3'-GGTTAATCCCAATCCCAATCCC-5' (complementary strand)
b) 5'-CCAAUUAGGGUUAGGGUUAGGG-3'
Um, **WHICH** DNA sequence is "THIS" DNA sequence? The one given to us in (a), or the complementary one we just figured out for (a)? We get two totally different answers depending upon which strand's sequence we use.
I am going to ASSUME (ALL OF US ARE FORCED TO ASSUME ONE WAY OR THE OTHER, because your teacher is a fail) that it is the complementary sequence we figured out for (a), because it runs in the correct direction (3'->5') for transcription, and because it is the last strand alluded to before the use the word "this".
For transcription, we again apply the base pairing rules, writing the complementary base beneath each of the bases in the original strand. However, since RNA has U instead of T, wherever there would be a T in the RNA we use U instead.
3'-GGTTAATCCCAATCCCAATCCC-5' (DNA template strand)
5'-CCAAUUAGGGUUAGGGUUAGGG-3' (mRNA)
c) Telomeres.
Vertebrate telomeres have repeated TTAGGG sequences, and unicellular eukaryotes have a similar sequence that is repeated.
This Site Might Help You.
RE:
76. 5’-CCAATTAGGGTTAGGGTTAGGG-3’ a) Draw the complementary DNA strand b) Transcribe this DNA sequence into RN?
76. 5’-CCAATTAGGGTTAGGGTTAGGG-3’
a) Draw the complementary DNA strand
b) Transcribe this DNA sequence into RNA
c) Where in eukaryotic chromosomes might this sequence be observed?
a) GGTTAATCCCAATCCCAATCCC
b) GGUUAAUCCCAAUCCCAAUCCC
Trust me on this, I'm in A.P. classes and just got 102% on a genetics test.
oh...didn't realize someone else answered, and sorry I can't help you with C.
5’-CCAATTAGGGTTAGGGTTAGGG-3’
A = T (or U for RNA)
G = C
a. GGTTAATCCCAATCCCAATCCC
b. GGUUAAUCCCAAUCCCAAUCCC